
If I had an alien or an uninformed observer looking over my shoulder at work I am sure they would think that I have the weirdest job in the world. Sometimes I think I have the weirdest job in the world. And I am not just referring to plaint hairstyling.
Sometimes when I receive a DNA sequence file I have to correct some of the letters because the sequencing machine reads them incorrectly. But if you didn't know what I was doing it would appear as if I am just making up random letters and modifying them how I want.
Sometimes I feel like my job is to sit there and type random letters for a living.
As an experiment I typed some random letters of the DNA variety and did a search to see if my random letters matched anything out there in the real world.
Here are my letters:
Those random letters partly matched genes from rice, the zebra fish, the weed that I happen to work on, a watermelon virus, a thingamajiggy called Medicago truncatula, and a wotsadoodah called Populus trichocarpa.
You see, it was that easy. With a wave of my fingers, I conjured up bits of genes.
If I make the string of letters any longer it no longer matches anything, but I reckon if you had x
amount of monkeys on typewriters (where x = loads) and y amount of time (where y = probably quite a long time) one of them could eventually type out the human genome. Of course by then the sun will have swallowed the earth, but monkeys are patient.
So while I am not just putting whatever letter I feel like into my sequences to spice them up or anything, I could if I wanted to. I could type a g instead of a c and turn a plant growth gene into a jellyfish mating gene. Oh yes, I have the power.
MWAHAHAHA <=== evil mad scientist laugh.
Aside: I wonder if the letters:
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGAT
translate to any kind of gene, like say a bowel movement gene perhaps, or maybe one for sphincter diameter?
I have to wonder these things to entertain myself, otherwise the tedium of typing random letters for a living may start to make me go mad and ... oh I dunno, go give plants makeovers or something.


12 comments:
You've lost it today, haven't you?
I like this one: Medicago truncatula. Such a cool word.
Are you saying that people have actually looked at all of those things, documented their letters and then put them somewhere for you to look them all up?
That is amazing. What some people would pay to have access to a database like that.
Don't see your job as the mundane entering of random letters, but as a way of writing and preserving the blueprint of the universe!
SonnyvsDAn: oh yes there is a database of millions of bits of sequences, as well as whole genomes. They are entirely and utterly free and anyone can use them at any time. So you have access if you so wish to fiddle with bits of sequence too!
Science is all about sharing infor, in a jealously guarded and competetive kind of way :)
Ladyfi: playing with the sequences and the letters is definitely one of my favourite parts of my job. I wish I could do it all day, but then maybe I would get tired of it.
Po...when are you going to create your own Frankestein???
wahahahahahahahaha about GATGATGATGATGAT!
Well, if its any comfort we're taught to decipher why people like the images they do: which is always "It's pleasing to the eye.
Duh.
Give plants a makeover? *rubs her chin. Interesting.
Ches: I already have, ches, I already have. I have set a date for his release but am keeping it under wraps. His name is: Frankenfly. He kind of mutated whilst I was attacking my fly infestation with dubious chemicals.
Paula: are you sure there is no Freudian reason, like it pleases their eye because it reflects their father blah blah? Maybe I should stop reading psychology books hey?
P.S. you have the coolest hairstyle ever!
My word verification is "pulab".
So why don't you see what the serach for GATGATGATGAT... turns up?
PS: Monkeys are not patient. Only seamonkeys.
Po- well it could possibly. But its more about forms. Like Triangles makes one feel stable, circles are naturally attractive and are cute, reflecting infinity... psychology is more in a form thing me thinks.
Plus I like to think of Freud's theories as more philosophy than psychology although the two are so closely intertwined, because most of his theories he links to mythology and how the "origins" of man and their relations to god(s) are a reflection of inner psychological attitudes but it gets you to thinking. If in fact that was so then surely the time in which these stories were made up would be a factor in these things and seeing as we have evolved as man surely then our inner psychology has also evolved, perhaps warped and many derivatives of other influences thus Freud's theories are not truly psychology but more philosophy.
Okay I talk too much.
Thanks about the hair- but I've already changed it- my hair styles last about a month at a time. 3 months if I like it a lot. I hate my current one so I'm waiting till this month ends so that I can get a new one. yay! :) I wanna put pink in!
Tamara: maybe I shall! I will probably have to reduce the number of gats though.
Paula: what a cool idea, that myths have influenced our psychologies. I find psychology to be a mythical science because it is not really a science, it is something in between science and myth and philosophy.
Definitely go pink!
Interestingly enough, I used to have to do what you do - correcting outputs from sequencers....ah...the memories come flooding back now....except I was do some shrimp reproduction gene. Don't think I was very good. Maybe that's why I'm not doing it anymore. Hehehe...
Dora: really? Were you a biologist? What did you have to do? That is really cool!
Oh...how I would love to me able to say, "Oh hi! I am a biologist..." Hehe.
No, I was merely doing a degree in biotechnology and spent my last year trying to love murdering shrimp and turning them into sequences of letters...
I realise I like to eat them more. ;)
Post a Comment