Pages

Monday, 1 June 2009

Where's the gat?*



AGTCTTGATGATGATGATTTTTCTAGTGATGATGAT

This is DNA. And also a random string of meaningless letters.Whichever does it for you.

A
t work I have to do the thing where you stand up in front of the people and do the mouth-moving and the sound-producing and hopefully the sense-making too, although in my case the last is dubious.

This is guaranteed to reduce me to a two year old child. I want to blub, I want to stamp my foot and I want to refuse to do it. Because it terrifies me and makes me miserable and is a form of torture so exquisite that the Spanish Inquisition is clearly alive and kicking, cunningly disguised as a Powerpoint presentation.

I know I am resorting to histrionics and being a big baby, but I really really despise public speaking. I get so nervous and my brain freezes. What is the use of that?

Whatever. I can moan forever, but I have to do it and in order to have it ready for Thursday I am working at home, furiously typing "gatgatgat" again and again across my screen, and if you didn't know, that is quite rude in Afrikaans.

This is what I am spending my evening doing, checking my A's, my G's, my C's and my T's and using "Find" to look for naughty words.

Meh.

And what's worse is, what's worse is that I have a song by Miley Cyrus in my head. Need I say more? No, because she's just being Miley. Excuse me while I go and cough up a furball of despair at my musical repertoire.

Catch you on the flip side of the double helix coil. Hopefully I will find lots and lots of red wine there.


*hole

15 comments:

expateek said...

Moet jy in Afrikaans praat? Dit sal 'n bietjie verskriklik wees!!

Ches said...

I like the DNA part. DNA rocks!

She can always just be Meilie? Meilie Van Der Merwe!

sleepyjane said...

Eeeek! Public speaking. I am terrified of it!

Good luck Po! x

Tamara said...

Rescue remedy. Do they have that in Britland? Works wonders.

6000 said...

Annual General Tortoise.
Cape Town Tortoise.
Granny Action Therapy.
Gin And Tonic.
Good At Tapdancing.
Generally Alive Tortoise.
Tirades Timelessly Transported.
Thwarted Colleagues Tire.
And Get The.
Gin And Tonic.
Gina And Tonia.
Gin And Tonic.

po said...

Expateek: haha, neee, maar ek dink dit sal makliker wees want niemand sal my verstaan nie and ek kan nonsens praat!

Ches: Mielie Cyrus, OMG that is hilarious. It is her official new name.

sleepyjane: me too, me too, and it is so unneccessary, you know?

po said...

Tamara: I have no idea. Have never tried it. Will check it out asap. Does it have lots of caffeine?

6000: Deeep. I like the generally alive tortoise. and The gin and tonics, but I prefer wine.

Are tortoises good at tapdancing?

And all I saw was "gat". Granny action therapy sounds much better.

BecauseIcan said...

Try renting a Body Double...
Preferably one that come home and cook dinner and stuff before leaving..

Or you can just pitch up naked.. no one will notice anything else ;-)

Champagne Heathen said...

Have some water to drink before hand (and during). Don't talk too fast, but concentrate on talking slowly & calmly. All those other tips you've learnt beforehand. And know that most folk are stressing their way through most public speaking events... you can always see it when you know the signs of stress...cause you've felt the exact same way. And then just talk like you'd talk to your book club or mates around a pub table.

GOOD LUCK! :)

Rox said...

Ugh, I hate public speaking as well - the best thing I can do is learn my 'lines' really well and prepare... but even then I will mess it all up by speaking too fast or blushing.

P.S. Miley Cyrus song = sneaky and evil, I get those stuck in my head too!

Helen said...

I get nervous and talk fast- like finishing a 20 minute talk in 8 minutes...

Rescue remedy is a herbal thing, it got me through my drivers test! the other thing that I find helps is to psych yourself up about the topic - get so excited (about your GAT?) that you wANT to tell people about it.

Good luck! I hope it goes well!

angel said...

And I love public speaking!!!

Dash said...

you poor sad sack!

YOu know, if you just tell yourself that you aren't terrifies it becomes a lot easier. It seems like an easy thing to say, but the truth is you know your topic, if you remind yourself that you are smarter than everyone else in the room its really not bad!

po said...

becauseIcan: hmmm, me naked in front of people is more terrifying than public speaking!

champagneheathen: I bet noone is as terrified as me! Thanks for the tips, do you have any for dealing with a Miley infection?

Rox: my problem is that it stresses me out so much that I try to pretend it is not happening and then I don't practice... oh dear.

Helen: apparently I speak too fast too. But I figure I don't want to bore people. Can try the psyching thing.

Angel: seriaas? Please can you come and do it for me, you would be my hero!

Dash: but I'm not smarter, and I think that is the problem, my audience is some of the best scientists in their field. And I am not even a scientist. This does not help confidence levels I must admit.

LadyFi said...

Hilarious post! I do feel your pain at PowerPoint presentations... or death by bullet points.

Good luck! May you survive to drink all that red wine.