Tuesday, 29 September 2009

This time last year...


I was going for job interviews. Boy am I glad that is over for now. Not a pleasant thing. I feel for anyone facing that challenge at the moment. It is pretty awful trying to sell yourself and feeling so examined and inadequate. And just generally terrified.

I took this photo this time last year after an interview, when Oxford was still nothing but a tourist attraction to me.



I am so lucky to be working in this beautiful city, which I am only starting to explore now. For the first few months I was in survival mode, scuttling in and out of the city like a startled hamster. Now I am finally taking the time to enjoy the place. I work with really pleasant people, which has not always been the case in my working life, and a friendly department, and the work is just fine. I really am lucky.

Now if I could just find the eject button marked "builders", all would be swell.

I know I complain about not fitting in, because I am not a scientist at heart, and that is never going to change, but if I have to work in the field, then this job suits me very well. And judging by my state of mind last year, being employed is definitely preferable to lurking around my flat.

It was also around this time last year that I started getting actual readers to my blog! Sweeeet. This was very exciting, because I had been plodding along for quite some time with no clue of how to find other blogs or how to attract people to mine.

According to my blog, this time last year I was committing fashion crimes, feeling concerned about the price of chocolate digestive biscuits, obsessing about South Africa, studying, and visiting the chiropractor.

Bloody hell, except for the job, nothing has changed at all.

What were you up to this time last year?


Monday, 28 September 2009

Mad house

At work today on our floor we have no:

  • water
  • fume hood (for working with dangerous chemicals)
  • cold room for storage
  • boss
  • lift
  • corridor
  • sanity

Somehow despite me having to walk up two floors and across to the next building for pretty much EVERYTHING, work is still expected to happen.

Well, I haven't been doing so much exercise lately so here's my chance.

Thursday, 24 September 2009

Dear Universe


A few quick questions:

1) Why roundabouts? For a start, when I first heard traffic circles called by that silly name, I couldn't figure out why you would put a kids' spinning ride in the middle of the road.

And now they torment me. The UK is covered in roundabouts. I understand intellectually why they are useful, but try being intellectual when you are terrified out of your wits in a moving object you can barely steer, trying to get the guts to zip in before some car rides up your ass. EEP.

Never mind indicating and all that other crap you are supposed to do with your left toe, which seems to be the only appendage not wrestling with other bits of the car.

I long for the traffic lights that dominate SA. Although apparently in SA there are these things called four way stops which are a bastard (or so my Irish friend tells me). This is news to me. I had not the faintest clue what a four way stop was, in fact I think I denied to him that they even existed.

Come to think of it, traffic circles could greatly reduce hijackings and smash and grabs in SA.

Whatever. Driving sucks like electrolux. But I'm sticking with it until I a) get my licence or b) die in the process. Please note, universe, option a) is my first choice.

2) why a chronic eye infection? A mere eye infection I could deal with. But one that lasts (according to the doc) months or even years? Why?? Months or even years of pussy, itching, crusty eyes? At least I pussed it onto BFG, so we can share love-pus. Hmmm, gooey.

Oh, and I have a cold. The mucous just mixes with the pus in an interesting gloop all over my face. I wonder if it is good for the skin? Because I am producing industrial quantities of the stuff.

3) why is my back not healed now? This bullshit started in 2006. Please universe, let me off on good behaviour? This pain is getting a little old. And so am I. I need my back back. Back.

My chiropractor is loving it I'm sure.


I am starting to think I have pissed (pussed? I am from Durban after all) you off or something, O universe.

But then:

- all my experiments worked yesterday
- they have started asking people to take their bags off seats in trains so we can find seats now,
-and I had pizza for breakfast.

Universe you are sending me mixed signals here. I am confused.

I think you must be a Virgo.

Tuesday, 22 September 2009

There's something about Virgos

rawrrrrrrrrr


There really is.

I have always been somewhat dubious about the whole Zodiac determining personality thingy. Supposedly the position of the sun in relation to the earth as you are squeezed from your mother's loins defines whether you are outgoing or prefer your own company.... You can see why people have trouble with this concept, right?

I don't really have a clue what being a "Leo" means except that I am supposed to be outgoing and attention-seeking, and stubborn. Check to the stubborn. Outgoing - maybe not. Attention seeking is a difficult one because although I am really shy I think deep down I crave attention, but when I get it I don't know what to do with it and it embarrasses me so I run away from it.

A confused Leo is what I am. It's all a bit blah blah to me.

I have no ability to recognise people by their personalities. Scorpios and Aquariuses and Cancers - I have no idea who is who in the zoo.

Except for you Virgos. I have noticed that there are quite a few of you out there in blogland. In fact I seem to read more Virgo blogs than any other type.

You Virgos are all instantly recognisable to me. It is uncanny. You are all individuals of course, but something about you is exactly the same. Even if I have met you only through your writing, you are just unmistakeably Virgoese.

You Virgos are all very intense. Shoowee but you are intense. And I think I give the impression of being intense to people. As a result I seem to attract Virgos in droves, possibly seeking out someone who they think will get them.

The thing is, I am intense, but I am intense for a fuzzy cuddly kitty cat. I just cannot match up to the intensity of a Virgo.

Also, Virgos take things (including themselves) seriously, and my ragging and poking lightheartedness is often taken the wrong way. And as a result there is a certain pattern to my relationships with Virgos.

All of them have been difficult. It is tempting for me to say it is because Virgos are difficult, but it could be that the common denominator here is actually me (couldn't be!) so it is better if I say the relationship as a whole is difficult. By difficult I mean hard work.

Some of my most intense, rewarding and best friendships have been with Virgos, but boy were they hard work. And worth it.

There are many other Virgos with whom I have non-starter relationships. We know each other, we like each other, but we just struggle and struggle to connect. It is like we just keep trying to touch hands and missing. It is weird. We tend to get frustrated with each other and so I can never become close friends with this subgroup.

There are some Virgos I choose not to be friends with because I can feel that we will not hit it off at all, and both of us would probably get badly hurt in the process. I think they feel it too and we mutually choose to remain acquaintances.

And then there are the Virgos with whom I have had fierce, mutually abusive relationships. Some of these also fall into the category of close friendships. I think that when a Virgo discovers that my intensity does not run as deep as theirs, sparks start to fly. I just can't match your bottomless depths dudes, I am wired to loll in the sun and eat raw steaks, mkay?


I read in some suspect description of relationships that Leos have something to teach Cancers, and something to learn from Virgos. That sounds incredibly lame. But if it is true, then I have a feeling that whatever it is that you are trying to teach me, Virgos, I am NOT GETTING IT!

Could you be a little more direct? Try spelling it out? This furry feline is no good at mind games.

What am I missing here?

I think that whether this Zodiac shizzle is real or not, I am fated to have many Virgos in my life. One thing I have learned from you is that if you work hard at a relationship, it can be most worthwhile.

But if you just aren't connecting with someone, it is nobody's fault (blame it on the sun) and there is no need to waste energy on it.

Oh yeah, and there is no such thing as a "light friendship" with a Virgo.

Does anyone else have this weird thing with Virgos? Or any other star sign? Is there a particular sign that just stands out to you?

Thursday, 17 September 2009

Criminal foodstuffs



One of the original ideas I had for this blog was to record all the bizarre things that have happened to me. I don't think I have a particularly fascinating life, but some friends at university were always saying I should write a book called "The life of_ "(<== insert Po's real name here) because basically I am a freak who does freakish things.

I think mostly they were referring to the fact that I would buy coffee every single day and almost every time I would drop it while trying to carry files and books and open the door to our building. I bet there are permanent coffee stains in those hallowed halls with my name on them. My life was on action replay.

But I think that would make for boring reading.

However some other weird stuff has happened to me. Like for instance, I have been a victim of CRIME. Yes, me. A South African. But not just any crime. Special crime.

Wait for it...


I was samped.


This adventure happens in Cape Town. The story actually makes me feel very guilty, and you shall see why.

A friend known as Mango and I were walking from Mowbray* to somewhere near Groote Schuur Hospital to visit someone. While we were walking a group of girls passed us. They were eating a delicious meal of piping hot takeaway samp**.

As they passed, I thought that one of the girls said something to me. I didn't hear what she said, but in my sad little brain, I thought she might be asking for money, as this happened to me frequently in the Mowbray area. I was not sure, but just in case, I shook my head ever so slightly and mouthed no, and we walked on.

The next thing I knew, we were samped and the girls marched off.

When I say we, I should probably add that almost the entire quantity of hot samp covered my friend. I had a few mild splats on my shoe and clothes but Mango was coated in samp. It looked like some drunk had puked all over her.

We were in shock, trying to work out exactly what had happened. I really was not sure if my slight shake of the head to an imaginary request for money had triggered samp falling from the sky, but if there was a trigger then that must have been it. The fact that none of the vengeful samp was actually on me caused me much mirth and Mango some consternation. She did not enjoy the experience, I can tell you.

We walked the rest of the way all sampy and gross and a startled jogger freaked out at what he thought was a puke-covered girl, which caused Mango to lose it a bit and tell the jogger off. Other passersbye had similar reactions. I was in hysterics for most of the way.


Waste of good samp, in my opinion.

I know my assumption that the samper was asking me for money was just terrible. It was my immediate reaction when anyone I did not know ever spoke to me on the streets, because it often happened. I assume the girl and her friends were just eating and passing by and said something (who knows what) and I misunderstood. I feel bad. Talk about assumptions being the mother of all samp-ups. I hate assumptions. They are evil. And I was a prime suspect.

But it was fucking funny.


*mediumly dodgy area of Cape Town, also where my free Willy encounter occurred.

** a degermed product of maize. Apparently.

Tuesday, 15 September 2009

Surprise!


I have been given even more awards by kind people.

Helen gave me this:




for writing from the heart (or whatever it is a seamonkey has)


and Paula made this award specially for me:




How cool is that?


I am sure the world is saturated with fascinating facts about me, so I am going to unleash just one upon you all today:




I am standing behind you right now.



boo.

Monday, 14 September 2009

Saffa stuff

9


This is a symbolic interpretive picture of the movie. Work with me here. I was too lazy to look for a good image.


I
finally saw it! I think the UK was the last corner of the earth to be invaded by the (hopefully not Parktown) prawns, but I finally saw District 9. Almost every blog I have come across has blogged about it, so damnit I refuse to be left out.

(possible plot spoilers ahead!)

It was good! I cannot believe I enjoyed a movie about aliens, but it happened. I am so not an alien person, or an action person. And when I heard the plot line I was convinced I would not like it. I mean, how obvious is the Apartheid/ Xenophobia metaphor? Could they not have made it slightly more subtle?

I was wrong though because it worked. I am not sure how but it did. The metaphor translated well to the screen. The documentary style was good, it was real and gritty and dirty, not whitewashed Hollywood. And the acting was natural; apparently Sharlto Copely improvised most of his lines, and his dialogue did seem to just flow out of his mouth. He played a bumbling doos very well.

Apparently there had been talk of using Tom Cruise's voice over Sharlto's.

CRINGE. They made the right choice. Nuff said.

The movie was not perfect. I was left wondering what exactly I was supposed to feel or understand at the end. It did not have a coherent ending at all.

I have heard that there is talk of a sequel. Oh God no. There should never be a sequel to a good movie, it will denigrate the integrity of the first, no doubt.

I can't say the movie had any kind of message to it, except maybe that humans are fuckers. I don't think that all movies should have messages, but it felt like this was trying to carry one but never completed the idea. But it was still good. The way I decide if movies are good or bad is just by a feeling, and I got the "good" feeling from this movie.

The thing that puzzled me the most though, was "The Nigerians". Not just a group of Nigerians, or some Nigerians, but "The Nigerians". Tamara, and Africa is a country also mentioned the portrayal of the Nigerians in the movie.

I am not sure if the director used them to fulfill a cliche because he wanted to show us how biased all South Africans (and most of the world) are against Nigerians, or if he just bought into the cliche for the convenience of his movie. Seeing as the xenophobia theme is strong in the movie I doubt he could have missed the obvious xenophobic connotations of "the Nigerians" so I feel he must have done it on purpose. Any thoughts?

There are about 4 movies a year that I think are good. This was not my favourite but it makes my good list. I am not sure that the audience we were with quite knew what had hit them. I heard one guy say "what the hell was that all about?"

But by bliksem, BFG and I got it.


That is all I have to say about the movie, and that was far too much already. Go see it.

Friday, 11 September 2009

10


The lovely Being Brazen gave me a lovely award, and I am supposed to list 10 random things about me but I do believe that that is impossible because I have listed so many random things about me that I am no longer random.

So in the time honoured tradition of her blog I am going to post

10 things I learned this week instead. Although it may turn out to be just 10 random things about things.


1) baking is for me, a very dangerous sport. And I am not referring to burning myself on the oven tray or flinging icing sugar all over myself (I flung icing sugar all over myself). You see, if other people do not finish your baked goods, then they are left there all alone, crying, begging to be eaten, to be warm and safe in your tummy... yeah. Burp.

2) I seem to be surprisingly good at baking, considering the sugar-flinging etc. Baking is remarkably similar to lab work, if you are precise in your amounts and follow the instructions, things should work. Aha <=== hollow laughter.

3) I have no self control if there are brownies in the house. Food is my nemesis, and I can eat until I am sick.

4) I am as confused and as lost at what to do in terms of my future as ever. Maybe this will never change.

5) my back is far from healed, in fact it has had a painful regression. Patience is something I must attain in this regard.

6) 10 things in one week? That is way too many things to have learned. Hey, I saw an article about Winston the speedy pigeon in the UK metro newspaper. Go Winston!

7) attacking someone's stupidity or weakness with hollow sarcasm does not impress me. Sarcasm, while amusing, is cowardly if used as the only means of attack or defence.

8) English people over the age of 26 use up all of their paid holiday to work on their houses, it seems. They really like to keep their houses nice here.

9) I have no idea how to get into my lab tomorrow. Every entrance has been blocked off by builders except for an underground mole-like tunneling system that confuses me so that I wander around in it for 10 minutes only to come out in Perth. I would take a compass but there's no point seeing as North is meaningless to me. Do you think I know where North is in relation to my lab? Ha.

10) come to mention it, I actually have never used a compass to find North before. Are the sharp pointed ends you stick into the paper when you make the circles used to fend off underground mole giants?

On the list of 10 things to learn next week: compass 101.

I award the sword-wielding lizard lady, I think she knows who I mean,
and the mohawked creative lady who is not so fond of capitals.


bye.

Thursday, 10 September 2009

"So how should I presume?"

You know when there is someone who you think epitomises genius and whose words never fail to blow you away?

I feel like that about T.S. Eliot.

I am no scholar, and I don't always understand what the hell he is on about. And probably his poetry is way out of literary fashion, but to me he is the best poet who ever walked this earth.

You don't need to tell me he was a difficult bastard because I do not care. I believe in separating art and artist. His poems are things detached from who he was. And they are amazing. Here is a sample:


...Do I dare

Disturb the universe?
In a minute there is time
For decisions and revisions which a minute will reverse.
For I have known them all already, known them all:
Have known the evenings, mornings, afternoons,
I have measured out my life with coffee spoons;
I know the voices dying with a dying fall
Beneath the music from a farther room.

So how should I presume?...

(From The love song of Alfred J. Prufrock).


Is that not genius? I could paste endless quotes here and they are all amazing. This dude speaks to me to my core. This poem was published in 1917. Imagine writing something so fundamental that people can identify with it nearly 100 years later?

T.S. Eliot rocks my little worldweary world and if I had a coffee-spooned fraction of his way with words I would be one satisfied seamonkey. Well, that is a lie because it is against human nature to be satisfied. But I would be dissatisfied in a satisfied kind of way.

Who rocks your world? Writer, dancer, banker, boxer, gardener, sinner, saint or otherwise?

Tuesday, 8 September 2009

Builders in the building.



Here a builder, there a builder, everywhere a buttcrack...

We have a builder infestation at work to go along with the flies, their maggoty offspring, the aphids and the other unknown insects that chew on my plants.

Oxford is basically one permanent building site, which is miraculous considering there is absolutely no space left in this city. They are tearing buildings down and putting up new ones and renovating all over the place. And since about January it has been our turn.

It was allright while they were doing their thing on the upper floors, , but now they are on our floor! The corridor is blocked off so we have to go downstairs just to get across the building. We have no lift so we have to carry everything up and down multiple flights of stairs. Some people have dozens of trays of soil to carry.

And they are creeping ever nearer my actual lab.

Soon they will be drilling away IN our lab, and apparently this shall go on for 3 months. The dust. The noise. The ladders and huge men and random flying saws (it happened) to dodge. Something tells me sanities shall be hanging by slender threads by the end of this. How am I supposed to produce world class science, huh? Yeah yeah, so I didn't before but it could have been imminent.

Since they are knocking down whole rooms in our lab, every available space we have left is currently covered in stuff from those rooms. We are all stumbling over boxes and equipment every time we move. It is just madness. I sense the tension and the drills have not even moved in yet.

The builders are really good guys and do their best to accommodate us. It is not their fault that there are some very miserable people in labcoats wandering around these days, covered in a fine film of dust.

I foresee only one solution. A three month holiday.

Aha, bet you never saw that one coming. Sadly my superiors did not share my sentiments. Yet. Wait until the drills start I say; just wait.

You may have picked up that I have been feeling somewhat fragile in the mental department recently, but I must warn you that when the noise circus moves in I will probably start raving about badgers in my belfry or capybaras in my cranium or marsupials in my meninges.

Don't say I didn't warn you.

Friday, 4 September 2009

Hello darkness my old friend


As the days grow darker and the icy wind wraps itself around my bones, my body has had a strange and disturbing reaction. One of familiarity. Not a welcoming feeling, but a feeling that things are back to normality. That this brief time when I could walk around without a jersey was merely an anomaly. And it sure was brief, bloody hell.

This unsettles me big time. I don't think I am adapting to the cold or anything because I still need to say the words "frik it is freezing" every time my brain realises it is freezing, ie. once per minute <== goldfish syndrome. People still stare at me in disbelief when they see how cold I am.

But my body is starting to see it as normal. Normal to be shivering and cold and tired and sad all the time? Oh boy.

I should try to see this as a positive thing. Maybe with time I will grow to love winter, and maybe if I ever leave here I will actually miss winter, miss the initial burst of energy the drop in temperature brings before it all seeps out and hibernation hits. So I should appreciate the icyness and make the most of it now.

Or some such psychobabble crap.


Bring out yer dead coats, fellow Northern Hemispherers, for the the time to battle the elements has begun once again. Who shalt win this annum?

Thursday, 3 September 2009

I write letters for a living.


If I had an alien or an uninformed observer looking over my shoulder at work I am sure they would think that I have the weirdest job in the world. Sometimes I think I have the weirdest job in the world. And I am not just referring to plaint hairstyling.

Sometimes when I receive a DNA sequence file I have to correct some of the letters because the sequencing machine reads them incorrectly. But if you didn't know what I was doing it would appear as if I am just making up random letters and modifying them how I want.

Sometimes I feel like my job is to sit there and type random letters for a living.

As an experiment I typed some random letters of the DNA variety and did a search to see if my random letters matched anything out there in the real world.

Here are my letters:


TAGTTGACGATATAAATAGCTAGATGAAACCCCATTACCCTGTGACAGTGGCT

Those random letters partly matched genes from rice, the zebra fish, the weed that I happen to work on, a watermelon virus, a thingamajiggy called Medicago truncatula, and a wotsadoodah called Populus trichocarpa.


You see, it was that easy. With a wave of my fingers, I conjured up bits of genes.

If I make the string of letters any longer it no longer matches anything, but I reckon if you had x
amount of monkeys on typewriters (where x = loads) and y amount of time (where y = probably quite a long time) one of them could eventually type out the human genome. Of course by then the sun will have swallowed the earth, but monkeys are patient.

So while I am not just putting whatever letter I feel like into my sequences to spice them up or anything, I could if I wanted to. I could type a g instead of a c and turn a plant growth gene into a jellyfish mating gene. Oh yes, I have the power.

MWAHAHAHA <=== evil mad scientist laugh.


Aside: I wonder if the letters:

GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGAT

translate to any kind of gene, like say a bowel movement gene perhaps, or maybe one for sphincter diameter?

I have to wonder these things to entertain myself, otherwise the tedium of typing random letters for a living may start to make me go mad and ... oh I dunno, go give plants makeovers or something.

Tuesday, 1 September 2009

Edinburgh

festival. fringe festival. book festival. Islam festival. Edinburgh Tattoo. people. swarms of. castle. dead volcano. trip over people. jugglers. swords swallowers. acrobats. drummers. kilts. bagpipes. unicyclists. flyers. everywhere more flyers. cardboard ice-cream van. stripper. dancers. unicyclists.

sun-boiling-wind-icy-freezing-rain-wind-sun-rain-wind-sun-rain.

ghosts. torture. history. ghouls. haunted tunnels. comedians. more unicyclists. bad comedians. funny comedians. dodgy pandas. baked potato. boy in labcoat. elephant puppet. man in bird suit. man in Elvis suit. cannibal with dating issues. Englishman, Irishman. Scots. Funny Canadian. every other kind of man.

unicyclists.


I went to Edinburgh this long weekend, and these are just a few of the things I saw. It appears that the poor city of Edinburgh has decided that if foreigners must flock to their streets, they must get it over with and squeeze every possible event and festival into one month, so it was a bit manic. Talk about visual overload, I am not sure that I have processed it all.

It was totally awesome.