Tuesday, 30 June 2009

Si si si siesta





Doo bee doo bee doo. I am back. And the crowd goes wild.

I am not sure if it is because I have been traveling a lot lately or what, but the post-holiday blues have hit me hard this time, harder than after Vietnam.

It is a little disturbing how little my real life excites and inspires me. Actually it just depresses the crap out of me. A rut is not the word. Every spare moment I have out of work seems to be recovery time. But what exactly am I recovering from? My life is not that hectic. I wish I could do more, much more fun stuff, but I never seem to have the energy.

I do know that every time I come back from a sunny place I feel amazing for a week or so before it all seems to fade away. I have known for a while that I feel healthier, more positive and more energetic in warm countries. I have the urge to do exercise, whereas when I am cold eating is the most appealing form of exercise.

I know that the holiday I just spent in Spain would not appeal to everybody. In fact, I reckon it would be many people's idea of hell. We stayed in a refugio (which is like a youth hostel for outdoor people) at the edge of a canyon. We shared a stone hut with 9 people. It can be a bit smelly and cramped. And you had to pay 2 euros to shower, so lets just say I did not shower every night (ahem. I shall leave out the specifics here). There were bugs everywhere. We cooked pasta on our camping stove, and ate bread and cheese the rest of the time.

But it was all so good. The rock in the canyon was just beautiful, cliff after cliff of perfect honey-coloured limestone with tufas and stalactites and mites and drips and blobs. Enough climbing for months and months. The saddest thing is that I am not able to climb most of it because I am too crap, and with my feeble arm, the chances of me ever climbing it are slim. But it was still so rad. And the weather was warm but not too hot, juuuust right (said Goldilocks).

The friends we were climbing with are on a year long trip around the world, seeking two things, good weather and good climbing. And I wish so much I had the means to do something like that too.

Life becomes so simple when your only aims are to eat, climb and sleep in a beautiful place each day. I know that life cannot be that way all the time, but for a year or so it could be. If money suddenly decided it liked me after years of strained relations.


Pretty weird that my ambition in life is to become an unwashed climbing bum, but right now the whole rainy rat race extravaganza is not my bag. Not at all.


Is this not a gorgeous hunky piece of rock?

Friday, 19 June 2009

Stuff

  • There is a man at my work who looks like Mr Burns. A carbon copy. For true. It is unnerving. I would post a picture but it seems inappropriate.
  • Last Friday I bought three books on a three for two special, hoping to have something to read in Spain. By Wednesday I had finished them. Bugger. So yesterday I went and bought three more. That is thirty quid I have spent on books in the last week. I seem to have been taken over by some kind of reading fever.
  • I attended a seminar yesterday which amused me greatly. Sadly if you never studied Biology in any form, this will not amuse you at all. The guy played us a short movie of his work accompanied by a song entitled "Sweet home apparatus". It was an ode to the Golgi apparatus. The words go something like this:

On the endomembrane system inside of a cell,
There's a groovy little organelle.
It isn't a place you can find in an atlas,
That's right, you guessed it: the golgi apparatus.

It's the golgi apparatus,
Yes the golgi apparatus
Don't care who's starin' at us
In the golgi apparatus.

  • And it only gets better after that.
  • Yes, I am a nerd of the highest order.
  • Here is a picture of the Golgi apparatus, in case you were burning to know.


  • RAD, is it not?
  • I am going on holiday and it will be 30 degrees, sweeet! I need to thtart practithing my lithping and my grathiathes and thtuff.

Adios amigos.

Wednesday, 17 June 2009

Totally Cream Crackered


I seem to be suffering from an annoying fatigue lately. I have no energy to do anything, certainly not write on this blog. And there is nothing to write about anyway, that is for sure.

Everything is so stagnant right now, perhaps my life is putting me to sleep? Or the dreary mundanity of it all? I know I should try to find something fun, an activity maybe, (street dancing perhaps? ) to make things more interesting but it all seems like such a mission when you get home so late, and are so tired you can hardly move, never mind do physical activity.

Life is sorely lacking magic these days. You could argue that I should be the supplier of the magic, but sod that, I do not have the energy. I need divine intervention and nothing less.

I just hope that this fatigue has an obvious explanation, like hormones. It may not be "that" time of month but I figure we have hormones in our bodies all the time, and they are doing their cycling and peaking and troughing all the time, so it is ridiculous to call ourselves "hormonal" at just that one time. Maybe I am hormonal now, even though I am not "hormonal". You follow me here, with all the inverted commas?

I hope it is hormones so that it is not some other inexplicable thing that will drive me unwillingly into the clutches of the NHS, for I would rather eat broccoli than suffer that fate.

My trust in the NHS was greatly "strengthened" <== even more inverted commas- this weekend, after my sister told me about her recent visit to the doctor. She has high arches, caving ankles, back pain, and other problems as well. Her doctor told her that "she is too tall". Well. That is useful information. And what the crispy creme donut is she supposed to DO about it? Where should we amputate? Top or bottom pray tell?

Um. Ja. Excuse the NHS rant. To know them is to love them.

I am going away to Spain next week. I know it seems that I am on holiday all of the time, but this is not true, it has been a whole long and exhausting month since my last holiday. A whole month people!

It is a climbing holiday, so I am not sure how restful it will be , but I plan to spend hours lazing in the sun. It can take a reeeeal long time to put climbing shoes on you know. Like, an entire day.

This post has no coherence to it at all. No point either. Your hair looks nice, did you do something with it?

Friday, 12 June 2009

The puppet man.

Sheldonian Theatre with a bad case of dandruff.


I did something exhilarating yesterday. I went and saw J.M. Coetzee read an extract from his latest work-in-progress at the Sheldonian Theatre in Oxford.

I know this may not knock everybody's socks off but it sure did it for me. Excuse the nerdfest that is to follow.

I have read and studied some of the man's books, and while I can't say I
enjoyed or liked them, they were mesmerising none the less. He manages to create a starkness that is striking, and his books never fail to give me a really uncomfortable feeling. The mark of true genius, I reckon.

I am a bit in awe of him, after all he won the Nobel Prize and is probably South Africa's greatest literary export.

I still kick myself when I think that he was lecturing in English at my University back when I was struggling to decide whether to study English or Biology. At the time I chose Biology because I though it would be easier to find a job. Ha I laugh in scorn. If only I had known the twisted and convoluted system that is research Science, perhaps I would have been tutored by the great J.M Coetzee instead.

I think I underestimated the nature of this event somewhat. I pictured it to be small, intimate. I expected a reserved, polite, perhaps slightly bored audience. I did not think that that many people read his books or were interested in him. This was a tad idiotic in hindsight.

I was not prepared for the magnitude of it all. The theatre is not that big, but it does have balcony seating, and it was packed to the max and the audience were buzzing. I suppose there is no better place for this kind of event than Oxford. The room was full of highly educated people who know far more than me about Coetzee's novels and their inner workings, and they were visibly excited to see the man.

It was great to be surrounded by such a receptive audience, it felt as if we were about to see a rockstar. The anticipation was tangible. When he came in I could barely stay seated I was so excited.

He read us some excerpts from the final instalment in his fictional autobiography series, called
Summertime. In it, the fictional Coetzee is dead, and people are being interviewed about their impressions of the man.

It was a fascinating way for him to present his ideas of himself, and the ideas he possibly feels that others have of him. Or it is all made up. Only he knows.

In the book a lady describes Coetzee as a puppet man, detached from life, merely going through the motions. Someone who could never be considered a great man because he was a man without fire, a man who could not dance.

Afterwards as I was standing in the looong queue to get my worn copy of Disgrace signed, I may have engaged in one of those fantasies, you know, you must have had these (maybe it is with a rockstar or an actor, or a world-renowned Immunologist, whatever) where your idol sees something in you, something special, and takes you aside, whereupon you instantly connect and engage in deep and meaningful philosophical debate, or discuss white blood cells, as it may be. Come on, admit it, I cannot be the only one?

Anyway, I was imagining I could probe his mind a bit. Did he feel like he was a puppet man, and how did he feel about the fact that in the eyes of all of us he is indeed a great man? Does it unsettle him, does he feel like a fraud? Is it exhausting to have to pretend to be genial and sign our books when he wants to be away from our conceptions of him?

But what I really wanted to ask him were surprisingly mundane things. Does he miss South Africa now that he is an Australian citizen? Does he feel alienated, does he feel like he belongs nowhere, does he know who he is now, did he ever? Does he love Australia, and never look back? What does he think about identity, and what shapes it? Does he feel a strange burden in being a white South African, a redundancy? Or does he think all that is a load of bollocks and just get on with life?

I guess I just want to talk to someone about these things but cannot find anyone who is receptive. Most people seem to want to talk about crime or sport or weather or politics or nookie. I feel like he is someone who would have had answers for me.

But maybe he would have talked about how much he misses Ouma rusks. Who knows?

As it was I managed to say hello, smile at him and say thank you before I had to move on for the next person.


And that will definitely do.

UPDATE: review here.

Tuesday, 9 June 2009

"Skaw me a smoke maw china" *

I think my claim to being a 90's-rock-loving musical dinosaur has finally crumbled to dust. I am not sure if this is a good or a bad thing or just a thing. Currently my ipod is filled basically with Bollywood jingles.

Yes, I am rocking out to "Jai Ho" from the
Slumdog Millionaire soundtrack, and not that pseudo crappy Pussy Cat Dolls version. Pah. I mean the real one from the movie, the Oscar-winning Hindi version (with a hint of Spanish). Bailar bailar.





I admit this music is not my usual fare, but I loved the movie and ever since I saw it I have mysteriously started enjoying this song and others from the soundtrack.

So what did people think of the movie? I am interested to know. I loved it. I thought it was different and interesting and beautifully shot and entertaining in a way that few movies are these days. And I am not talking about what Hollywood movies define as "entertainment".

I have seen very few Hollywood films in the last few years that I have enjoyed. BFG and I love movies but we always end up resorting to foreign films because we just aren't into the Hollywood formulaic vibe at all. But that's just us.

I have heard two main areas of criticism aimed at
Slumdog Millionaire, both mostly by Indian people.

The first I do not agree with. This is the criticism that the movie did not do enough to raise social awareness of the terrible poverty in Mumbai slums. I studied a tiny bit of aesthetic theory, and when it comes to this argument I am very old fashioned.

Films are art. They are there to engage our imaginations, to entertain us, to be beautiful, and all of those other vague things that art does, that no one can really define. To me a really good film is beautiful, it feels whole and complete at the end, it is unusual and unpretentious.

If you set out to make a film to try and change the world, chances are you are going to make a crap film. A crap film will not help your cause. If you don't hook the audience so that they are utterly absorbed into your story, then they will come away with nothing and do nothing to help your cause.

I really feel that if you want to bring about social change, you should make a documentary. Of course some feature films do bring about social awareness, but this should be a side effect. I feel that if it is the main purpose then in most (but not all) cases the artistry will be lost, and with it a receptive audience.

Ever since the film has been out, the child actors, all of whom live in real Mumbai slums, have been in the English newspapers roughly every week. Two of the poor kids have had their houses flattened by Indian policemen. Danny Boyle, the director of the film, set up a fund to help them find new places to live.

I promise you that before the film, kids in Mumbai slums featured in the daily newspapers roughly never. I am not saying that the movie brought about some amazing miracle, but the awareness in England is definitely greater than before.

But this movie was intended to entertain us, that motive is clear. It is a far-fetched, imaginitive love story,like all good love stories are.

The second criticism is easier for me to accept, although I really need the opinions of Indian people here.

I have heard complaints that the movie is not nearly realistic enough, in fact it is far-fetched to the point of ridiculous. I cannot comment because I am not Indian and know nothing of daily life in India, but I must admit it was stretching my powers of belief when the kids miraculously learned English about a third of the way through the film, and then suddenly everything, including TV shows were in English.

It is a pity that the film was in English at all, it should have been entirely in Hindi. The English of course was to pander to us Westeners who are apparently too lazy to read. Personally I prefer watching a movie in the relevant language with subtitles any day.

For me the worst kind of film is that Hollywood film with the American star speaking in English with some ridiculous foreign accent, because I cannot even pretend to pay any attention to the story, I am too busy cringing at the abomination that is the accent. I have always had a thing about accents. I notice them before anything else.

Brad Pitt in "7 years in Tibet" is a good example. Lawd but that was painful, and I love Brad Pitt. Get a freaking Austrian if the movie is about an Austrian, and let the guy speak German instead of heavily accented English. Sorry Brad, but your rugged looks did nothing to rescue you in that one.

Sadly I know that an authentic Austrian movie would sell a fraction of what Brad Pitt sounding like a wally would sell.

But I for one will never grace a cinema with a movie featuring any Hollywoodised "Souff Effriken" EVER again. There is just no point. I cannot watch the actual movie. It can be a laugh, or sometimes it just makes me want to cry. But in no way am I able to follow the storyline.

Yes, the director of Slumdog is British, but at least
Slumdog has authentic Indian people from actual India (except ironically for the main character, played by Dev Patel, who is English), and when they speak English, at least their accents are real. We have to give the movie credit for that level of authenticity.

But I don't know, perhaps for an Indian person, watching
Slumdog Millionaire was like my experience of watching Blood Diamond.

Any Indian person out there? Or else, any opinionated person out there? I would love to know some opinions other than mine.

Personally I have watched the film twice, will happily watch it again, and as an aside,

JAI HO to you.


When in doubt, Jai some ho's. And then everything will be Jai Ho. Hohoho. Jai.


*I dunno. Too much for me to explain. Ask Leo.

Saturday, 6 June 2009

I want

How freaking cool does this look?!



Clicky the picture to go to the site.

I have made it clear that I am a sucker for well packaged bits of merchandise and this is the epitomy for me. It is a book by Lauren Beukes called Moxyland, which seems to be a sci-fi futuristic adventure in Cape Town 10 years from now.

I have not read it, but check it out, it comes with a toy, how cool is that toy, I WANT that toy. The toy is made by some impoverished women in Montagu. I love Montagu. When I lived in Cape Town, Montagu was practically my second home. If you climb and you live/d in South Africa, you have probably heard of and been to Montagu. I have so many good memories of Montagu.

And, and it comes with its very own soundtrack. How cool is a book with a soundtrack? A homegrown soundtrack inspired by the book. I have been listening to it and it is very funky and gritty and dark. I likey. You can listen to it here.

Damnit, why do I have to live all the way over here in darkest Europe, I want the book and more importantly I want the awesome toy of awesomeness!

I really am every retailers dream.

I may ship it over via Kalahari, or I may wait til my next visit, but either way, I am not good at waiting for things I want. Want. it. now. Anyone from Saffaland feel like flying over to the UK to deliver it to my door? I will make you tea. I will throw in a digestive too.

Friday, 5 June 2009

Fashion advice

Is it, persay, acceptable to colour in the huge scuff marks on one's black work shoes with a black pen or marker?





It worked for me at school.

Thursday, 4 June 2009

Strong like itty bitty seamonkey

Mielie* (Van de Merwe) Cyrus, the pop pop pop star. Mwaha. Corny, I know.


Apart from making up random letter combinations while working feverishly at home (and er,blogging), and singing along to Mielie Cyrus (thanks Ches) there is one other exciting thing on the seamonkey grapevine.

I am now officially lifting 2 kgs per arm.

I know, you are floored. The power, the sheer awesomeness of my muscular prowess. Wanna see my bicep?

It is pretty exciting for me though, because I cannot remember the last time that 2kgs was a comfortable weight to handle.

Back in I think 2006, I did something weird to my upper back, that resulted in a humungous spasm. I had the spasm for a year, but since it didn't stop me from doing anything, I totally ignored it. Mistake, I know.

Anyway, a year later, there was a bit of a movement or a slippage, or something that felt very icky, and after that my entire upper back and shoulder areas in both arms were fooked.

After an extra 2 years of hoping, and painkillers, and physio, and an MRI scan, and specialists, and a misdiagnosis and a pointless operation, I had: one very sore arm.

Sore from the frigging operation,and sore from the original injury which of course has not miraculously gone away. I have also developed a deep and irreversible distrust of the NHS (the UK's National Health Service). This distrust was more than 2 years in the making, and it runs deep. You really do not want to hear my full opinion on this matter, it would run to many angry pages.

Oh yeah, I also screwed up my lower back in 2008, but that is another story. The NHS were no help there either (read impressively useless).

I think that my arm has mostly recovered from being sliced, but I am trying to accept that the mysterious original problem will never go away. A chiropractor is helping a bit.


But it seems that the years and years of rest for my feeble little arm have helped, because I am currently able to climb and as of now lift a whole 2 kgs, and while I can feel the twingy bits and they do hurt, the don't hurt tooooo badly (yet). It is a comfortable weight.

I am so excited; 2kgs!

This leads me to the happy conclusion that I must weigh 4kgs, seeing as I can climb, and my arms can deal with my full body weight, so it must be 2 kg per arm. It is a simple matter of physics, my dear Pinky.

Today I can lift 2kgs, tomorrow... well, still 2 kgs. I shouldn't get carried away, for there lies the path to other injuries.

But next year, maybe even 3.


*corn on the cob

Monday, 1 June 2009

Where's the gat?*



AGTCTTGATGATGATGATTTTTCTAGTGATGATGAT

This is DNA. And also a random string of meaningless letters.Whichever does it for you.

A
t work I have to do the thing where you stand up in front of the people and do the mouth-moving and the sound-producing and hopefully the sense-making too, although in my case the last is dubious.

This is guaranteed to reduce me to a two year old child. I want to blub, I want to stamp my foot and I want to refuse to do it. Because it terrifies me and makes me miserable and is a form of torture so exquisite that the Spanish Inquisition is clearly alive and kicking, cunningly disguised as a Powerpoint presentation.

I know I am resorting to histrionics and being a big baby, but I really really despise public speaking. I get so nervous and my brain freezes. What is the use of that?

Whatever. I can moan forever, but I have to do it and in order to have it ready for Thursday I am working at home, furiously typing "gatgatgat" again and again across my screen, and if you didn't know, that is quite rude in Afrikaans.

This is what I am spending my evening doing, checking my A's, my G's, my C's and my T's and using "Find" to look for naughty words.

Meh.

And what's worse is, what's worse is that I have a song by Miley Cyrus in my head. Need I say more? No, because she's just being Miley. Excuse me while I go and cough up a furball of despair at my musical repertoire.

Catch you on the flip side of the double helix coil. Hopefully I will find lots and lots of red wine there.


*hole